Page 5 of 11
					
				
				Posted: Fri Feb 16, 2007 2:53 pm
				by Luminous
				McPackage wrote:He hasn't added me yet, although he has logged in since I submitted the request.  Since I was the first last time, maybe he's waiting for another person.
He hasn't accepted my request yet either. When I said "I'm in", I actually just meant that my request had gone through.
 
			
					
				
				Posted: Fri Feb 16, 2007 3:03 pm
				by Luminous
				
			 
			
					
				
				Posted: Tue Feb 20, 2007 9:31 pm
				by McPackage
				Just got a message from walterdw on myspace:
You kids get off my space. You don’t know me well enough yet.
 
			
					
				
				Posted: Tue Feb 20, 2007 10:00 pm
				by sonieee
				yeah I got that message too, just now.
McPackage wrote:Just got a message from walterdw on myspace:
You kids get off my space. You don’t know me well enough yet.
 
 
			
					
				
				Posted: Tue Feb 20, 2007 10:08 pm
				by theresascraps
				He has a new vid up! i believe it could have something to do with genetic research. Check it out and you will see.
Theresa
			 
			
					
				
				Posted: Tue Feb 20, 2007 10:19 pm
				by theresascraps
				here you go off the new walterdw vid. I entered the numbers from the opening sequence 
36gy77
it led my to craigslist and the posting below. i need help, the whole gene thing is so not my game!
theresa

 
			
					
				
				Posted: Tue Feb 20, 2007 11:20 pm
				by Luminous
				Here's what the Base 64 from the Craig's list message translates to:
We knew the Soviets had them.  They were at least ten years ahead of
us.  The Kirov and Sverdlovsk facilities were producing results before we 
had even begun.  It wasn't hard for some half-witted military drones to 
weaponize the standards, although I do feel for the whitecoats.  Lovett 
wanted something more from us, the intellectual elite.  We were to 
produce a more discrete product.
gaagagcaagcgccatgttgaagccatcattaccattcacatccctcttattcctgcagctgcccctgctggg
agtggggctgaacacgacaattctgacgcccaatgggaatgaagacggatccaccacagctgtcgagtg
ggaaatctgggactggagggggctggtgagaagggtggctgtgggaaggggccgtacagagatctggt
gcctgccactggccattacaatcatgtgggcagaattgaaaagtggagtgggaagggcaagggggagg
gttccctgcctcacgctacttcttctttctttcttgtttgtttgtttctttctttcttttgaggcagggtctcactatgttg
cctaggctggtctcaaacggatcctcctggctcgactctagtgatcctcctgcctcagcctttcaaagcacca
ggattacagacatgagccaccgtgcttggcctcctccttctgaccatcatttctctttccctccctgccttcatttt
ctccccaatctagatttcttcctgaccactatgcccactgactccctcagtgtttccactctgcccctcccagga
tccgaggttcagtgttttgtgttcaatgtcgacatatgagcatggcgaccagcaccttcagtgcgcagtgtgg
cccggagcatcattacctggctgaacattcttctatttttaatggcgtcttcagccagcagcttaaaaacaac
cttatctactttccctcctcctactttccctcctcccgcttgagggtaggccccatccccccctttcgagtacatg
gatccgaattgcacttggaacagcagctctgagccccagcctaccaacctcactctgcattattggtatgag
aagggacgagggggaggggatgaagaagaggtgggttggatcagagaccaagagagagggtagca
agtctcccaggtaccccactgttttctcctggggtaagtcataagtcggttgaggggagatgaggctaggct
ctggatatctgcagtacccagattggccccactgttcctcttccttccatcgaacctttctcctctaggtacaag
aactcggataatgaggatcctaaagtccagaagtgcagccactatctattctctgaagaaatcacttctggc
tgtcagttgcaaaaaaaggagatccacctctaccaaacatttgttgttcagctccaggacccacgggaacc
caggagacaggccacacagatgctaaaactgcagaatctgggtaatttggaaagaaagggtcaagag
accagggatactgtgggacattggagtctacagagtagtgttcttttatcataagggtacatgggcagaaa
agaggaggtaggggatcatgatgggaagggaggaggtattaggggcactaccttcaggatcctgacttg
tctaggccagggtcgagaatgaccacatatgcacacatatctccagtgatcccctgggctccagagaacct
aacacttcacaaactgagtgaatcccggatccagctagaactgaactggaacaacagattcttgaaccac
tgtttggagcacttggtgcagtaccggactgactgggaccacagctggactgtgagtgactagggacgtg
aatgtagcagctaaggccaagaa
1(+8 ) 1 3(+7) 2(-1) 3(-6) 1(+4) 1(+3) 2(+3) 5 1 6 1 1(-1) 4 7 2 6 9 9 1 5 4 1 1 2 3 1 2 4 4(+1) 5(-1) 5 3 9 9 1 3 1(+1) 1 4 1(+2) 1 2 2 2 2 1 2 2 2 2 2 2(+1) 4 1 7 6 1 6 7 1
			 
			
					
				
				Posted: Tue Feb 20, 2007 11:25 pm
				by theresascraps
				I am sorry if i screwed up the screen. I don't know how to do the screencaps thing. So, what does the message mean??How did you decipher it so quickly???
Theresa
			 
			
					
				
				Posted: Tue Feb 20, 2007 11:41 pm
				by Luminous
				theresascraps wrote:So, what does the message mean??How did you decipher it so quickly???
Theresa
With my handy dandy cheat decoder 
 http://www.paulschou.com/tools/xlate/
 
http://www.paulschou.com/tools/xlate/
I wish I was as good at decoding DNA strings. Hopefully Walter will teach me a thing or two about that 
 
Edit because TiNaG
 
			
					
				
				Posted: Tue Feb 20, 2007 11:49 pm
				by Luminous
				Whoa! Check this out!  I just did a google on Kirov and Sverdlovsk. Look what I found!
http://www.house.gov/jec/hearings/intell/alibek.htm
I haven't had a chance to read through it yet but it looks pretty interesting.
 
			
					
				
				Posted: Wed Feb 21, 2007 1:23 am
				by TOSG
				Interesting - this new DNA sequence contains a lot of X-chromosome material, which fits in with what some of us were speculating earlier.
Also, it looked like the baby in the video had bent bones?  Interesting.
I'll see what I can do with this new sequence.
			 
			
					
				
				Posted: Wed Feb 21, 2007 1:59 am
				by TOSG
				Hmm, I played around with a bunch of stuff, but I'm coming up dry.  I wonder whether there are any clues about which enzymes to use...
			 
			
					
				
				Posted: Wed Feb 21, 2007 2:06 am
				by TOSG
				Hmmm....could "Terminus A Quo" refer to the Taq restriction enzyme?  Hmm....
			 
			
					
				
				Posted: Wed Feb 21, 2007 2:09 am
				by Luminous
				How did you isolate the enzyme last time?
			 
			
					
				
				Posted: Wed Feb 21, 2007 2:15 am
				by TOSG
				Mostly lucky guesses, to be honest.  I looked for commonly used restriction enzymes that cut out the sequence that didn't match up with known DNA (as I assumed that TravelerJ designed it specifically for this puzzle).